version
PlantPromoterDB promoter information of AK104514

Summary of Gene (AK104514)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0282900        NCBI 
Gene model AK104514  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 9753485-9754684)

Genome position     
from initiation codon
006-088-H05         
AK061166            
AK102161            
J033086G07          
J065157L12          
J065196F23          
J075088F10          
J100078D22          
TSS from cDNA
TSS information
AK104514                         5'->3' (+)
Promoter sequence









 
AK101658            
J033057I20          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104514

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+9754360-125
TSS clone peakGclone+9754382-103

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTG+97541299754136-356-349
 OsREG507GCCACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGACATGGGCTGATGGGCCGTG+97542169754235-269-250
 OsREG437ACATGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT            PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491  ATGGGCTG           PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG607        TGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590         GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490          ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445           TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504            GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAATA+97542519754259-234-226
 OsREG460AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596 GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCAAGAAGGCCCATGT+97542679754287-218-198
 OsREG435ACAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG            PPDB MotifGCCCA  PLACE Motif 
 OsREG430          AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517            GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437             GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCTAGCCCATTTAGGCCCATTT+97542919754319-194-166
 OsREG610TAATGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC           GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG432          AGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG422           GCCCATTT  GCCCATTT PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA       TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT         AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.