version
PlantPromoterDB promoter information of AK104548

Summary of Gene (AK104548)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0564400        NCBI 
Gene model AK104548  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 23351052-23352251)

Genome position     
from initiation codon
006-101-E01         
009-069-F12         
AK059949            
AK066183            
TSS from cDNA
TSS information
AK104548                         5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104548

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+23352026-26
TSS clone peakGclone+23352032-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGGCC+2335177923351786-273-266
 OsREG633TCCGGGCC PPDB Motif  PLACE Motif 
REGCCTCGCCCACCAAC+2335179823351811-254-241
 OsREG549CCTCGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520      CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCCCATCCA+2335184223351849-210-203
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAAC+2335194923351981-103-71
 OsREG587GAGGCCCA                          PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA       AGGCCCAAGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA              GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA                       PPDB MotifGCCCA  PLACE Motif 
 OsREG419       AAAAGCCC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG421        AAAGCCCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG426         AAGCCCAA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG459          AGCCCAAG                PPDB MotifGCCCA  PLACE Motif 
 OsREG497              CAAGGCCCAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430               AAGGCCCAAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG581                 GGCCCAAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG593                         GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.