version
PlantPromoterDB promoter information of AK104820

Summary of Gene (AK104820)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0104400        NCBI 
Gene model AK104820  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 225182-226381)

Genome position     
from initiation codon
006-022-H01         
006-026-B08         
006-028-D06         
006-030-C01         
006-034-A11         
006-037-B09         
006-037-B10         
006-042-A01         
006-043-A09         
006-055-E02         
006-061-B12         
006-064-F06         
006-078-G10         
006-079-G09         
006-080-A03         
006-080-B08         
006-084-H05         
006-100-E07         
006-110-E01         
006-110-G08         
006-118-D10         
006-119-B01         
006-120-C12         
009-188-F02         
AK060132            
AK071375            
AK104555            
J013036G10          
J013040J20          
J013091F10          
J013152O17          
J023044K17          
J023052J22          
J023081F23          
J023088I04          
J023092D12          
J023095C18          
J023121J21          
J023123D06          
J023128J03          
J023134F19          
J023138K23          
J023150K17          
J033103G13          
J043040L09          
J065012F09          
J065014I21          
J065077C07          
J065095D23          
J090021E10          
J100017L18          
J100045M19          
TSS from cDNA
TSS information
AK104820                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104820

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+225897-285
TSS cloneCclone+226139-43
TSS clone peakAclone+226179-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC+226153226160-29-22
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGGCCC+225633225640-549-542
 OsREG641TGGGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGGACCCG+225755225762-427-420
 OsREG569GGGACCCG PPDB MotifGGGACCC  PLACE Motif 
REGGTGGGTCC+225782225789-400-393
 OsREG622GTGGGTCC PPDB MotifGGGACCC  PLACE Motif 
REGTTATGGGCCGTGG+226048226060-134-122
 OsREG605TTATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG PPDB Motif  PLACE Motif 
REGACCCGCGC+226063226070-119-112
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 
REGGGGCCGGG+226072226079-110-103
 OsREG538GGGCCGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+226182006-120-C12, 006-118-D10, 006-061-B12, 006-080-B08, 006-030-C01, J023121J21, 006-078-G10, 006-055-E02, 006-100-E07, 006-064-F06

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.