version
PlantPromoterDB promoter information of AK104843

Summary of Gene (AK104843)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0459600        NCBI 
Gene model AK104843  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 22634325-22635524)

Genome position     
from initiation codon
014-073-C08         
AK071203            
J013036J08          
J013045M07          
J013045N07          
J013157N15          
J023030B16          
J023036P17          
J023039F16          
J023083E07          
J033037H04          
J033094M18          
J033115G21          
J033131C22          
J043030I03          
J043030L12          
J053047M19          
J053083G01          
J090014P06          
J090067H05          
J090090C07          
J090095F11          
TSS from cDNA
TSS information
AK104843                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104843

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+22635190-135
TSS clone peakAclone+22635204-121

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCCCCC+2263516122635170-164-155
Y PatchTTCCCCTCCTCC+2263521822635229-107-96
Y PatchCTCTCCCC+2263523322635240-92-85
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCGCGCG+2263508322635090-242-235
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGGCGGGCCCCACAC+2263511922635131-206-194
 OsREG619GCGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG567 CGGGCCCC     PPDB MotifACGGGC  PLACE Motif 
 OsREG641  GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611    GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535     CCCCACAC PPDB Motif  PLACE Motif 
REGCTCTCCGC+2263513922635146-186-179
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.