version
PlantPromoterDB promoter information of AK104984

Summary of Gene (AK104984)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0547200        NCBI 
Gene model AK104984  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 22443663-22442464)

Genome position     
from initiation codon
016-021-H03         
AK073078            
J065005L05          
J065039C06          
J065116H17          
J100046A17          
TSS from cDNA
TSS information
AK104984                         5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK104984

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-22444703-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCTT-2244467022444679-57-66
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCGTTG-2244474722444754-134-141
 OsREG495GACCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGCCCGGGCCCACACACC-2244479522444810-182-197
 OsREG539CCCGGGCC         PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA       PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA     PPDB MotifGCCCA  PLACE Motif 
 OsREG598     GCCCACAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG499        CACACACC PPDB Motif  PLACE Motif 
REGGTCCGTCCGTGTGGC-2244481722444831-204-218
 OsREG623GTCCGTCC        PPDB Motif  PLACE Motif 
 OsREG561 TCCGTCCG       PPDB Motif  PLACE Motif 
 OsREG573       CGTGTGGC PPDB Motif  PLACE Motif 
REGCAAGCCCATG-2244484922444858-236-245
 OsREG496CAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTCCGGCCCCACC-2244488322444894-270-281
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612    GCCCCACC PPDB Motif  PLACE Motif 
REGACTGGGCCCCGCCCACCAC-2244491622444934-303-321
 OsREG454ACTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG599          GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527           CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGGCCCACTCCAACGG-2244494222444961-329-348
 OsREG612GGTGGGGC             PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC            PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT        PPDB MotifGCCCA  PLACE Motif 
 OsREG532       CCCACTCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG548            TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGAGTTGGGCCGAGCCG-2244498722445001-374-388
 OsREG479AGTTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC       PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG      PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA     PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG540       CCGAGCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.