version
PlantPromoterDB promoter information of AK105022

Summary of Gene (AK105022)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0590200        NCBI 
Gene model AK105022  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 24683683-24682484)

Genome position     
from initiation codon
011-100-E06         
012-005-A05         
AK063416            
AK099235            
J065030D21          
J065031C10          
J065105A22          
J065173M19          
J075188F15          
J090050C15          
J100058K07          
TSS from cDNA
TSS information
AK105022                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105022

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-24682962-279
TSS clone peakAclone-24682957-274
TSS cloneAclone-24682949-266

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTGGGCCGGGGCCCATTA-2468301424683032-331-349
 OsREG626GTTGGGCC            PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563 TTGGGCCG           PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG538   GGGCCGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG647        GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG489         GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431          GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610           GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCTGG-2468304724683057-364-374
 OsREG553CGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGC-2468307024683077-387-394
 OsREG479AGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCT-2468315324683161-470-478
 OsREG607TGATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.