version
PlantPromoterDB promoter information of AK105063

Summary of Gene (AK105063)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0874800        NCBI 
Gene model AK105063  
Description 5'-3' exonuclease domain containing protein.  
#
#

Overview

Focused view (chromosome 1: 39715818-39714619)

Genome position     
from initiation codon
016-042-F01         
AK065916            
AK065991            
AK103577            
AK119315            
J013045N02          
J013045P10          
J013046K16          
J023106C06          
J033132P11          
J053023A11          
J053068H13          
J053071O13          
J053074M10          
TSS from cDNA
TSS information
AK105063                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105063

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-39714848-30
TSS clone peakAclone-39714835-17
TSS cloneGclone-39714831-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCAGC-3971491339714923-95-105
 OsREG419AAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG428  AAGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG464   AGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCTTTTGGCCCATAA-3971494239714962-124-144
 OsREG422AAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG660          TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488           TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630            GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605             GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTACTGGGCCAA-3971499239715002-174-184
 OsREG604TACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578  CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.