version
PlantPromoterDB promoter information of AK105399

Summary of Gene (AK105399)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0120000        NCBI 
Gene model AK105399  
Description Protein of unknown function DUF936, plant family protein.  
#
#

Overview

Focused view (chromosome 12: 950156-948957)

Genome position     
from initiation codon
011-024-E09         
TSS from cDNA
TSS information
AK105399                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105399

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-949199-43

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTCC-949168949177-12-21
Y PatchCCTCCTCCCC-949185949194-29-38
Y PatchTCTTCCCC-949201949208-45-52
Y PatchTCCTCCTC-949217949224-61-68
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCTGTC-949299949308-143-152
 OsREG514CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501  CACCTGTC PPDB Motif  PLACE Motif 
REGAAAGCCCATAT-949327949337-171-181
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCGAAA-949355949367-199-211
 OsREG437ACATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA PPDB Motif  PLACE Motif 
REGCCAGGCCC-949386949393-230-237
 OsREG524CCAGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGTGGCCCAAA-949399949408-243-252
 OsREG653GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.