version
PlantPromoterDB promoter information of AK105468

Summary of Gene (AK105468)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0737600        NCBI 
Gene model AK105468  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 30998305-30999504)

Genome position     
from initiation codon
014-094-E01         
016-093-B12         
AB038234            
AK101854            
J033069N12          
J043017A22          
J065154A20          
TSS from cDNA
TSS information
AK105468                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105468

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+30999052-253

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCT+3099904630999053-259-252
Y PatchTCCTCCTCCTC+3099905630999066-249-239
Y PatchCCTCCCTC+3099907630999083-229-222
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACTGGGCCGGGCCGA+3099890530998920-400-385
 OsREG604TACTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG       PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC    PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC   PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG  PPDB Motif  PLACE Motif 
 OsREG568        CGGGCCGA PPDB MotifACGGGC  PLACE Motif 
REGCTCCCCCACGGG+3099892630998937-379-368
 OsREG574CTCCCCCA     PPDB Motif  PLACE Motif 
 OsREG536  CCCCCACG   PPDB Motif  PLACE Motif 
 OsREG531    CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGTACTGGGCCGAGCCG+3099894330998957-362-348
 OsREG604TACTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG      PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA     PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG540       CCGAGCCG PPDB Motif  PLACE Motif 
REGGCTGGGCT+3099896930998976-336-329
 OsREG464GCTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCATCT+3099898630998996-319-309
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCCAAGCCCAGC+3099899930999009-306-296
 OsREG519CCAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG428  AAGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG464   AGCCCAGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.