version
PlantPromoterDB promoter information of AK105697

Summary of Gene (AK105697)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0586600        NCBI 
Gene model AK105697  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 29305747-29306946)

Genome position     
from initiation codon
AB096011            
AB096071            
AK106883            
J100047B14          
TSS from cDNA
TSS information
AK105697                         5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105697

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+29306618-129

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACGTGTCACT+2930633829306349-409-398
 OsREG434CCACGTGT     PPDB MotifACGT  PLACE Motif 
 OsREG509 CACGTGTC    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG477    GTGTCACT PPDB Motif  PLACE MotifTGAC 
REGGGTGGGCCCAGGGACCCG+2930635429306371-393-376
 OsREG628GGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG579   GGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG550    GGCCCAGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG569          GGGACCCG PPDB MotifGGGACCC  PLACE Motif 
REGGCCCACGTGGCG+2930641929306430-328-317
 OsREG449GCCCACGT     PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508 CCCACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG507   CACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448    ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCGTCCGATCCG+2930650029306511-247-236
 OsREG545CCGTCCGA     PPDB Motif  PLACE Motif 
 OsREG484 CGTCCGAT    PPDB Motif  PLACE Motif 
 OsREG589  GTCCGATC   PPDB Motif  PLACE Motif 
 OsREG541    CCGATCCG PPDB Motif  PLACE Motif 
REGCCCGTGGG+2930651629306523-231-224
 OsREG531CCCGTGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGGGCCGTCCGAT+2930652929306539-218-208
 OsREG624GGCCGTCC    PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG   PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA  PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT PPDB Motif  PLACE Motif 
REGGGCCGTTG+2930656229306569-185-178
 OsREG494GGCCGTTG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.