version
PlantPromoterDB promoter information of AK105829

Summary of Gene (AK105829)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0285400        NCBI 
Gene model AK105829  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 10145786-10146985)

Genome position     
from initiation codon
AK067208            
J065087M16          
J075002I19          
J075003I15          
J075046M23          
J075103C17          
J075123E14          
J080005C10          
J080005D24          
J080009F23          
J080010M20          
J080011L10          
J080013B20          
J080013N15          
J080014D18          
J080016A12          
J080016I11          
J080018H18          
J080020I11          
J080021E08          
J080025H23          
J080026J22          
J080028G20          
J080029L14          
J080030F14          
J080030O22          
J080032B09          
J080037O19          
J080039H17          
J080041F02          
J080044B11          
J080047B04          
J080049E21          
J080050C07          
J080051H12          
J080052C02          
J080053I16          
J080057E15          
J080060E08          
J080061G14          
J080063B19          
J080064F09          
J080064G02          
J080065N04          
J080067J19          
J080074H10          
J080076B15          
J080076J08          
J080077H08          
J080078K07          
J080081A09          
J080086H19          
J080086N02          
J080088D03          
J080088E23          
J080088G01          
J080093E19          
J080094A10          
J080097H13          
J080097J21          
TSS from cDNA
TSS information
AK105829                         5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105829

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+10146784-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTT+10146821101468283542
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCGTGGA+1014659910146606-187-180
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 
REGGTCCCTCA+1014664110146648-145-138
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGTCTCGGCC+1014673610146743-50-43
 OsREG635TCTCGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.