version
PlantPromoterDB promoter information of AK105865

Summary of Gene (AK105865)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0151500        NCBI 
Gene model AK105865  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 2544511-2545710)

Genome position     
from initiation codon
AK058389            
TSS from cDNA
TSS information
AK105865                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105865

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2545474-37

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGGCCCCTGGGCCCCACC+25452502545269-261-242
 OsREG538CCCGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG550       CCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579        CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647         TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641          GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631           GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612            GCCCCACC PPDB Motif  PLACE Motif 
REGGCAGCCCAACCACACACC+25452732545290-238-221
 OsREG591GCAGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC         PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595   GCCCAACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG499          CACACACC PPDB Motif  PLACE Motif 
REGGGCCCCACA+25453082545316-203-195
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA PPDB Motif  PLACE Motif 
REGCATCCACC+25453202545327-191-184
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGCCCACTTG+25453352545342-176-169
 OsREG498CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGGTGGGTCCCACCAC+25453502545363-161-148
 OsREG622GTGGGTCC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527      CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.