version
PlantPromoterDB promoter information of AK105925

Summary of Gene (AK105925)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0278900        NCBI 
Gene model AK105925  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 9543981-9542782)

Genome position     
from initiation codon
006-049-H12         
006-082-A07         
009-169-C04         
AK066019            
AY224460            
J065021K17          
J065141H24          
J065142J20          
J065152J03          
J065163A13          
J065191I21          
J065193K12          
J075003D01          
J075017D24          
J075060F20          
J075154C11          
J075173F04          
TSS from cDNA
TSS information
AK105925                         5'->3' (-)
Promoter sequence









 
009-059-G08         
011-001-D03         
011-080-B02         
015-006-H03         
D10396              
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK105925

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-9543157-176
TSS clone peakGclone-9543140-159

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACGGCCCAAAT-95431969543207-215-226
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493    GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTGGATGGGCTAATGGGCCCAACT-95432159543237-234-256
 OsREG534TGGATGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GGATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG466  GATGGGCT              PPDB MotifGCCCA  PLACE Motif 
 OsREG610         TAATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG431          AATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489           ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639             GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626              GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479               GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCGTT-95432629543272-281-291
 OsREG645TACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAGCCGTTGGAT-95433209543330-339-349
 OsREG469AGCCGTTG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548  CCGTTGGA  PPDB MotifCCAACGG  PLACE Motif 
 OsREG481   CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.