PlantPromoterDB promoter information of AK106696
Summary of Gene (AK106696)
|
Overview
|
Focused view (chromosome 5: 21046818-21045619)
|
Genome position
from initiation codon J065086G24 J075088C15 J075123N04 J075125N22 TSS from cDNA TSS information AK106696 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of AK106696
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 21042851 | -33 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | ACGCTATATATATATCGC | - | 21042872 | 21042889 | -54 | -71 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CACACACC | - | 21042922 | 21042929 | -104 | -111 | |||
| OsREG499 | CACACACC | PPDB Motif | PLACE Motif | ||||||
| REG | CCAACGGCCCAGATCACGCCACTGAC | - | 21042973 | 21042998 | -155 | -180 | |||
| OsREG518 | CCAACGGC | PPDB Motif | CCAACGG | PLACE Motif | |||||
| OsREG494 | CAACGGCC | PPDB Motif | CCAACGG | PLACE Motif | |||||
| OsREG423 | AACGGCCC | PPDB Motif | GCCCA, AAACG(C/G) | PLACE Motif | |||||
| OsREG445 | ACGGCCCA | PPDB Motif | GCCCA | PLACE Motif | AACAAAC | ||||
| OsREG565 | CGGCCCAG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG629 | GGCCCAGA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG486 | GCCCAGAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG502 | CACGCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG522 | CCACTGAC | PPDB Motif | PLACE Motif | TGAC | |||||
| REG | CCGTCCGATC | - | 21043006 | 21043015 | -188 | -197 | |||
| OsREG545 | CCGTCCGA | PPDB Motif | PLACE Motif | ||||||
| OsREG484 | CGTCCGAT | PPDB Motif | PLACE Motif | ||||||
| OsREG589 | GTCCGATC | PPDB Motif | PLACE Motif | ||||||
| REG | CACGTCTC | - | 21043030 | 21043037 | -212 | -219 | |||
| OsREG506 | CACGTCTC | PPDB Motif | ACGT | PLACE Motif | |||||
| REG | CCGATCCG | - | 21043106 | 21043113 | -288 | -295 | |||
| OsREG541 | CCGATCCG | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||