version
PlantPromoterDB promoter information of AK106752

Summary of Gene (AK106752)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0153200        NCBI 
Gene model AK106752  
Description Protein of unknown function DUF250 domain containing protein.  
#
#

Overview

Focused view (chromosome 6: 2741843-2743042)

Genome position     
from initiation codon
AK072625            
TSS from cDNA
TSS information
AK106752                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK106752

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2742657-186
TSS clone peakGclone+2742715-128

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCCACCGGGTGGGGCCCACCCCCACCAC+27424902742520-353-323
 OsREG613GCCCCCAC                        PPDB Motif  PLACE Motif 
 OsREG528        CGGGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG612          GGTGGGGC              PPDB Motif  PLACE Motif 
 OsREG631           GTGGGGCC             PPDB Motif  PLACE Motif 
 OsREG641            TGGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG647             GGGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG640              GGGCCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG628               GGCCCACC         PPDB MotifGCCCA  PLACE Motif 
 OsREG600                GCCCACCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG527                       CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCACGTCTC+27425402742547-303-296
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 
REGCGACCCGC+27426362742643-207-200
 OsREG552CGACCCGC PPDB Motif  PLACE Motif 
REGCGCGTCGCG+27426452742653-198-190
 OsREG559CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.