version
PlantPromoterDB promoter information of AK106905

Summary of Gene (AK106905)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0603400        NCBI 
Gene model AK106905  
Description Similar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit).  
#
#

Overview

Focused view (chromosome 6: 24752652-24751453)

Genome position     
from initiation codon
012-088-B11         
AK060002            
AK063544            
AK072067            
AK102325            
J065011H14          
J065020D09          
J065130O10          
J065132J07          
J075015L15          
J090039I22          
J090091K07          
J100022N15          
J100023E09          
J100052D21          
TSS from cDNA
TSS information
AK106905                         5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK106905

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24751728-76
TSS clone peakGclone-24751726-74

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCTCC-2475168824751699-36-47
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGGCCCAAAT-2475179324751803-141-151
 OsREG475AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCACA-2475182624751835-174-183
 OsREG655TAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCAAAC-2475184124751851-189-199
 OsREG647GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATTT-2475187124751879-219-227
 OsREG432AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422 GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCACA-2475188424751893-232-241
 OsREG655TAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.