version
PlantPromoterDB promoter information of AK106994

Summary of Gene (AK106994)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0499300        NCBI 
Gene model AK106994  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 2: 18384456-18385655)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK106994                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK106994

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+18384957-499

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCTCCGC+1838467318384680-783-776
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGCTTGGGCT+1838471618384723-740-733
 OsREG459CTTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGCTGGCCCACCAACCGTGGGCCAC+1838475118384773-705-683
 OsREG577CTGGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC              PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG520     CCACCAAC           PPDB MotifCCAACGG  PLACE Motif 
 OsREG547            CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571             CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC     GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653               TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCAATT+1838480118384811-655-645
 OsREG496CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460  AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCCTGGGCCTA+1838483018384839-626-617
 OsREG550CCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGCCCCCAC+1838487418384881-582-575
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGCTCCCCCA+1838489518384902-561-554
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.