version
PlantPromoterDB promoter information of AK107067

Summary of Gene (AK107067)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0896400        NCBI 
Gene model AK107067  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 40716971-40715772)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK107067                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK107067

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-40716082-111

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTC-4071606040716068-89-97
Y PatchCCCCCTCCTCCTCCCTCTC-4071608440716102-113-131
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCG-4071612340716130-152-159
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCCAACGGCC-4071613540716143-164-172
 OsREG518CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494 CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGAGCCGTTG-4071616940716176-198-205
 OsREG469AGCCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGCGTGTGGCCCACCCG-4071618940716203-218-232
 OsREG573CGTGTGGC        PPDB Motif  PLACE Motif 
 OsREG653   GTGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG654    TGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600      GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528       CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGGTCCCACCTG-4071621540716225-244-254
 OsREG650GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651 GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG514   CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCAACGGCT-4071624440716251-273-280
 OsREG469CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGCCAACGGCT-4071630640716314-335-343
 OsREG518CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG469 CAACGGCT PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.