version
PlantPromoterDB promoter information of AK107226

Summary of Gene (AK107226)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0156700        NCBI 
Gene model AK107226  
Description Lipolytic enzyme, G-D-S-L family protein.  
#
#

Overview

Focused view (chromosome 6: 2896811-2898010)

Genome position     
from initiation codon
J075021O05          
J075023M12          
J075041C14          
J075041C19          
J075064F08          
J075116I03          
J075123I02          
TSS from cDNA
TSS information
AK107226                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK107226

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2897788-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTGTATATAA+28977502897759-61-52
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGAGAT+28975522897560-259-251
 OsREG635GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485 GCCGAGAT PPDB Motif  PLACE Motif 
REGGCCCAGTAAGGCCCATGGGCCTTG+28975622897585-249-226
 OsREG604GCCCAGTA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG430       AAGGCCCATGGGCCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG474        AGGCCCATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG525          GCCCATGGGC     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517         GGCCCATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG497                GGGCCTTG PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCCAGCCC+28975902897602-221-209
 OsREG615GCCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAAC+28976462897653-165-158
 OsREG458AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGGGTGACGT+28977142897721-97-90
 OsREG447GGTGACGT PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.