version
PlantPromoterDB promoter information of AK107405

Summary of Gene (AK107405)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0136900        NCBI 
Gene model AK107405  
Description Protein of unknown function DUF296 domain containing protein.  
#
#

Overview

Focused view (chromosome 6: 1963506-1962307)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK107405                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK107405

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-1962581-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCCTCC-19625821962592-76-86
Y PatchCCCTTCTCCTCTCCTCTC-19625941962611-88-105
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTGGGCCCCACTCC-19626441962659-138-153
 OsREG599TGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG532        CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGGTGGGTCCCACCGCAC-19626671962682-161-176
 OsREG622GTGGGTCC         PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA       PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG500        CACCGCAC PPDB Motif  PLACE Motif 
REGACAGCCCAGCCCAGGGCCCGC-19626921962712-186-206
 OsREG435ACAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG619             GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGGAGACGTGGGC-19627521962762-246-256
 OsREG506GAGACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG449   ACGTGGGC PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGGTGACGTGGCCGTGG-19628661962880-360-374
 OsREG505GTGACGTG        PPDB MotifACGT  PLACE MotifTGAC 
 OsREG585  GACGTGGC      PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG521       GGCCGTGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.