version
PlantPromoterDB promoter information of AK107632

Summary of Gene (AK107632)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0326600        NCBI 
Gene model AK107632  
Description RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.  
#
#

Overview

Focused view (chromosome 3: 11981349-11980150)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK107632                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK107632

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-11980380-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTGGGCCGGC-1198062011980630-271-281
 OsREG478AGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGTCTGGGCCGTGGGCCCTTGGTGGGCCAA-1198064111980668-292-319
 OsREG629TCTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG                    PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT                   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504   GGGCCGTG                  PPDB MotifGCCCA  PLACE Motif 
 OsREG521    GGCCGTGG                 PPDB Motif  PLACE Motif 
 OsREG547      CCGTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG571       CGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG640        GTGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG475         TGGGCCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG599                 TGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628                  GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654                   GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660                    TGGGCCAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.