version
PlantPromoterDB promoter information of AK107853

Summary of Gene (AK107853)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0480600        NCBI 
Gene model AK107853  
Description Hypothetical protein.  
#
#

Overview

Focused view (chromosome 9: 19101138-19102337)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK107853                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK107853

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+19102112-26

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGCTATAAAA+1910206819102078-70-60
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGGGC+1910185919101866-279-272
 OsREG614GGCCGGGC PPDB Motif  PLACE Motif 
REGATCTGGGCCGTCC+1910188319101895-255-243
 OsREG486ATCTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584    GGGCCGTC  PPDB MotifGCCCA  PLACE Motif 
 OsREG624     GGCCGTCC PPDB Motif  PLACE Motif 
REGGATCCGACGG+1910190219101911-236-227
 OsREG588GATCCGAC   PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546  TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGACCCGCGC+1910193919101946-199-192
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 
REGGTCGCGCGCGCGAG+1910199319102006-145-132
 OsREG557GTCGCGCG       PPDB MotifACGCGC  PLACE Motif 
 OsREG617 TCGCGCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG558      CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGCACGTCACCGAGCCG+1910202719102041-111-97
 OsREG505CACGTCAC        PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447 ACGTCACC       PPDB MotifACGT  PLACE MotifTGAC 
 OsREG540       CCGAGCCG PPDB Motif  PLACE Motif 
REGCCCACCCG+1910205719102064-81-74
 OsREG528CCCACCCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.