version
PlantPromoterDB promoter information of AK108074

Summary of Gene (AK108074)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0560400        NCBI 
Gene model AK108074  
Description Protein of unknown function DUF862, eukaryotic domain containing protein.  
#
#

Overview

Focused view (chromosome 6: 22313510-22312311)

Genome position     
from initiation codon
                    
AK103575            
Os06g0560500        
TSS from cDNA
TSS information
AK108074                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK108074

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-22312705-195
TSS clone peakCclone-22312704-194

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCC-2231276622312773-256-263
 OsREG504CACGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCGATCCGACGTGTCC-2231283922312854-329-344
 OsREG541CCGATCCG         PPDB Motif  PLACE Motif 
 OsREG588  GATCCGAC       PPDB MotifCCGAC  PLACE Motif 
 OsREG483   ATCCGACG      PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG451        ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTTTCGGCC-2231287122312878-361-368
 OsREG634TTTCGGCC PPDB Motif  PLACE Motif 
REGTCAGGCCCAGGGCCCAGG-2231288222312899-372-389
 OsREG646TCAGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG473  AGGCCCAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG550   GGCCCAGGGCCCAGG PPDB MotifGCCCA  PLACE Motif 
 OsREG475        AGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG579         GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCAAA-2231290222312912-392-402
 OsREG645TACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCCATCG-2231293322312944-423-434
 OsREG615GCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553    GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-2231298522312992-475-482
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.