version
PlantPromoterDB promoter information of AK108131

Summary of Gene (AK108131)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0487500        NCBI 
Gene model AK108131  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 9: 19454670-19453471)

Genome position     
from initiation codon
J080062L16          
TSS from cDNA
TSS information
AK108131                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK108131

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-19453768-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCC-1945372619453734-56-64
Y PatchTCTCCCCC-1945374819453755-78-85
Y PatchTCTTCCCC-1945375819453765-88-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCAGCCCATTT-1945380919453824-139-154
 OsREG421AAAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491      CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432       AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422        GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCCAAT-1945383519453846-165-176
 OsREG614GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542  CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCATAA-1945387019453881-200-211
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605    GCCCATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.