version
PlantPromoterDB promoter information of AK108341

Summary of Gene (AK108341)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0451300        NCBI 
Gene model AK108341  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 5: 22209091-22207892)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK108341                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK108341

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-22208136-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCCCACCTGTCAG-2220818022208195-89-104
 OsREG641GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631 GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612  GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG514    CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436     CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501      CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551        CCTGTCAG PPDB Motif  PLACE MotifTGAC 
REGGCCCACGT-2220820022208207-109-116
 OsREG449GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGAGTGGGCCACCTCGCCCGGCCCAACC-2220827022208295-179-204
 OsREG478AGTGGGCC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 GTGGGCCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG549         CCTCGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG614             GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538              CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542               CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563                CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626                 GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595                  GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCGCG-2220831522208323-224-232
 OsREG559CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.