version
PlantPromoterDB promoter information of AK108435

Summary of Gene (AK108435)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0415500        NCBI 
Gene model AK108435  
Description Mitochondrial import inner membrane translocase, subunit Tim17/22 family protein.  
#
#

Overview

Focused view (chromosome 3: 17871650-17872849)

Genome position     
from initiation codon
J065182P12          
TSS from cDNA
TSS information
AK108435                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK108435

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+17872542-108

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCCCTCCTCTCCT+1787256117872577-89-73
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGCCCATCCA+1787229717872308-353-342
 OsREG618GCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534    CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCGTTGGAT+1787232217872329-328-321
 OsREG481CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGGCCCACGT+1787235417872361-296-289
 OsREG449GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGGGAGTGGGTCCCAC+1787236817872381-282-269
 OsREG532GGAGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG622   GTGGGTCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG637    TGGGTCCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650      GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGTGGTGGGCCCTGGCCCATCA+1787244517872464-205-186
 OsREG599TGGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG577         CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488          TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590           GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607            GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.