version
PlantPromoterDB promoter information of AK108529

Summary of Gene (AK108529)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0260600        NCBI 
Gene model AK108529  
Description CD9/CD37/CD63 antigen family protein.  
#
#

Overview

Focused view (chromosome 8: 9786914-9785715)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK108529                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK108529

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-9785926-12

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGCTATAA-97859539785961-39-47
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAGTT-97859729785979-58-65
 OsREG425GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGGTGGTGGG-97859909785997-76-83
 OsREG527GTGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGTCCACGCCCACACGCCACACG-97860129786032-98-118
 OsREG636TCCACGCC              PPDB Motif  PLACE Motif 
 OsREG598     GCCCACAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG526      CCCACACG        PPDB MotifGCCCA  PLACE Motif 
 OsREG502          CACGCCAC    PPDB Motif  PLACE Motif 
 OsREG573             GCCACACG PPDB Motif  PLACE Motif 
REGCCCAGCCCATGCCCATGT-97860409786057-126-143
 OsREG533CCCAGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG491  CAGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG467   AGCCCATG        PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437          GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCAAAA-97860689786078-154-164
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCTCAGCT-97860909786103-176-189
 OsREG593GTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT      PPDB MotifGCCCA  PLACE Motif 
 OsREG470      GCTCAGCT PPDB Motif  PLACE Motif 
REGAGTTGGGCCGAGA-97861109786122-196-208
 OsREG479AGTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC     PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635     GGCCGAGA PPDB Motif  PLACE Motif 
REGTGGGGGAG-97861729786179-258-265
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.