version
PlantPromoterDB promoter information of AK108777

Summary of Gene (AK108777)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0119700        NCBI 
Gene model AK108777  
Description Protein prenyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 1040650-1039451)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK108777                         5'->3' (-)
Promoter sequence








 
011-079-E04         
015-004-G12         
AK068133            
AK099224            
J013131K20          
J033088A06          
J090044D07          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK108777

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1039710-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCT-10397151039723-65-73
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAAATACGGCCCACT-10397611039781-111-131
 OsREG660TTGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT           PPDB MotifGCCCA  PLACE Motif 
 OsREG645          TACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445           ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564            CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478             GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAACA-10397891039799-139-149
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCCCAATA-10398041039816-154-166
 OsREG521CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596     GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGACATGGGC-10398221039829-172-179
 OsREG437ACATGGGC PPDB MotifGCCCA  PLACE Motif 
REGTCTGGCCCAACC-10398511039862-201-212
 OsREG638TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595    GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGGCCACACG-10399101039917-260-267
 OsREG573GCCACACG PPDB Motif  PLACE Motif 
REGGTCCCACCTG-10399401039949-290-299
 OsREG651GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG514  CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCCCACGCG-10399651039972-315-322
 OsREG530CCCACGCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.