version
PlantPromoterDB promoter information of AK108961

Summary of Gene (AK108961)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0474300        NCBI 
Gene model AK108961  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 7: 17748823-17750022)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK108961                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK108961

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+17749609-214

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCC+1774961217749620-211-203
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCATCCACC+1774939517749402-428-421
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGCGCCACGTGTCCGGGCCCC+1774942817749446-395-377
 OsREG448CGCCACGT            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT          PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451    ACGTGTCC        PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG633         TCCGGGCC   PPDB Motif  PLACE Motif 
 OsREG543          CCGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG567           CGGGCCCC PPDB MotifACGGGC  PLACE Motif 
REGATCCAACGGTC+1774946117749471-362-352
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG495   CAACGGTC PPDB MotifCCAACGG  PLACE Motif 
REGGTCGAGTC+1774947717749484-346-339
 OsREG586GTCGAGTC PPDB Motif  PLACE Motif 
REGCTGGGGCCCACA+1774951117749522-312-301
 OsREG580CTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGATCCGACCGTTGGA+1774954417749558-279-265
 OsREG588GATCCGAC        PPDB MotifCCGAC  PLACE Motif 
 OsREG495     GACCGTTG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548       CCGTTGGA PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.