version
PlantPromoterDB promoter information of AK109486

Summary of Gene (AK109486)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0346800        NCBI 
Gene model AK109486  
Description EAR repeat containing protein.  
#
#

Overview

Focused view (chromosome 4: 16515189-16516388)

Genome position     
from initiation codon
AK101242            
J033031P14          
J080306O15          
J080317H19          
TSS from cDNA
TSS information
AK109486                         5'->3' (+)
Promoter sequence


















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK109486

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+16516099-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCCTATAAATC+1651606316516074-126-115
Y PatchCCTCCCTCTC+1651605516516064-134-125
Y PatchTCCTCTCCTCTCCTCTCCTCTCCTCC+1651607316516098-116-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCCTATCGTGGGCCCGCGCGGCCCAATT+1651585016515883-339-306
 OsREG422AAATGGGC                           PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                         PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                        PPDB MotifGCCCA  PLACE Motif 
 OsREG601           TCGTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG571            CGTGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG640             GTGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG566              TGGGCCCG             PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619               GGGCCCGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG618                       GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563                        CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492                         GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433                          GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.