version
PlantPromoterDB promoter information of AK109597

Summary of Gene (AK109597)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0236900        NCBI 
Gene model AK109597  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 8: 8305820-8307019)

Genome position     
from initiation codon
J065010O13          
J065090B13          
J065158J03          
J075102M19          
J075157A02          
TSS from cDNA
TSS information
AK109597                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK109597

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+8306819-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCCCCTC+83067968306805-24-15
Y PatchCTTCCTCTTCTCCCCC+83068158306830-510
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGC+83065228306529-298-291
 OsREG592TTTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGAGGCGTGGACTGGGCCTG+83066748306692-146-128
 OsREG503GAGGCGTG            PPDB Motif  PLACE Motif 
 OsREG636  GGCGTGGA          PPDB Motif  PLACE Motif 
 OsREG454         ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473          CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513           TGGGCCTG PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCTTG+83066998306708-121-112
 OsREG459CTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG496  TGGGCTTG PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCAGCCC+83067288306739-92-81
 OsREG582GAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.