version
PlantPromoterDB promoter information of AK109819

Summary of Gene (AK109819)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0190100        NCBI 
Gene model AK109819  
Description Similar to Auxin-independent growth promoter-like protein.  
#
#

Overview

Focused view (chromosome 12: 4549160-4550359)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK109819                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK109819

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+4550145-15

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCCTT+45501164550126-44-34
Y PatchCCTCCTCTCTTTCTCTCTCTC+45501294550149-31-11
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGGGCC+45499384549945-222-215
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGCCAGCCCACCA+45499594549969-201-191
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGAGGGCCCAAT+45499844549993-176-167
 OsREG475AGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACCA+45499964550004-164-156
 OsREG462AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCATCA+45500074550017-153-143
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAATT+45500334550040-127-120
 OsREG433GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACCA+45500424550050-118-110
 OsREG462AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCATCA+45500544550064-106-96
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCACCA+45500764550087-84-73
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472  AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCATCA+45500904550100-70-60
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.