version
PlantPromoterDB promoter information of AK109828

Summary of Gene (AK109828)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0116600        NCBI 
Gene model AK109828  
Description F-box associated type 1 domain containing protein.  
#
#

Overview

Focused view (chromosome 5: 875569-874370)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK109828                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK109828

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-874614-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTCTATATAG-874639874649-70-80
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCC-874787874794-218-225
 OsREG504CACGGCCC PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCGCATGGGCTTT-874797874816-228-247
 OsREG476AGGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG           PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG643    GGGCCGCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG467          CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429           ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421            TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGGCTGGGCCCTGGGCCAT-874845874861-276-292
 OsREG620GCTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG475  TGGGCCCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG550       CCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578        CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487         TGGGCCAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.