version
PlantPromoterDB promoter information of AK110628

Summary of Gene (AK110628)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0439900        NCBI 
Gene model AK110628  
Description Mitochondrial glycoprotein family protein.  
#
#

Overview

Focused view (chromosome 8: 21485722-21486921)

Genome position     
from initiation codon
J065118D13          
TSS from cDNA
TSS information
AK110628                         5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK110628

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+21485716-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCC+2148573221485739-40-33
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTGGGGCCCATGTGGGTCCCAC+2148543321485455-339-317
 OsREG611TGTGGGGC                PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC               PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG517     GGCCCATG           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437      GCCCATGT          PPDB MotifGCCCA  PLACE Motif 
 OsREG622            GTGGGTCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG637             TGGGTCCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648              GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650               GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCGCCACGTC+2148546821485476-304-296
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGAACTGGGCCCATT+2148561221485624-160-148
 OsREG425AACTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431     GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCC+2148563821485645-134-127
 OsREG614GCCCGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.