version
PlantPromoterDB promoter information of AK110639

Summary of Gene (AK110639)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0683800        NCBI 
Gene model AK110639  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 6: 29369290-29370489)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK110639                         5'->3' (+)
Promoter sequence






 
                    
Os06g0683850        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK110639

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+29370189-101

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCCCTATATAAC+2937015129370162-139-128
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGGCCC+2936990129369908-389-382
 OsREG584GACGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGGCTCGGCCCAAAT+2936992429369938-366-352
 OsREG540CGGCTCGG        PPDB Motif  PLACE Motif 
 OsREG575   CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658    TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563     CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625      GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493       GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGGTCGAGTC+2936998429369991-306-299
 OsREG586GTCGAGTC PPDB Motif  PLACE Motif 
REGCACCGCAC+2937001729370024-273-266
 OsREG500CACCGCAC PPDB Motif  PLACE Motif 
REGCCGAGCCG+2937009029370097-200-193
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGCACGTCACGTCACC+2937010729370120-183-170
 OsREG505CACGTCACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447      ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.