version
PlantPromoterDB promoter information of AK110717

Summary of Gene (AK110717)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0592200        NCBI 
Gene model AK110717  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 24798223-24797024)

Genome position     
from initiation codon
AK065016            
AK099740            
J013001F14          
J013091C13          
J023036I21          
J033107P16          
TSS from cDNA
TSS information
AK110717                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK110717

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-24797482-259
TSS clone peakCclone-24797478-255

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCCTTCCTTCCTCCTCCTC-2479745924797482-236-259
Y PatchCCTTCTCCTCC-2479751724797527-294-304
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGACGCG-2479755024797557-327-334
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGGCCCCCACCTGTCAG-2479763424797648-411-425
 OsREG613GCCCCCAC        PPDB Motif  PLACE Motif 
 OsREG514   CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436    CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501     CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551       CCTGTCAG PPDB Motif  PLACE MotifTGAC 
REGGACAGGTGGGACCCACGCG-2479765424797672-431-449
 OsREG501GACAGGTG            PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG           PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG651    GGTGGGAC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG650     GTGGGACC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG648      TGGGACCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG637       GGGACCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG622        GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG530           CCCACGCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.