PlantPromoterDB promoter information of AK111037

Summary of Gene (AK111037)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0190900        NCBI 
Gene model AK111037  
Description Phytoene dehydrogenase-like protein.  


Focused view (chromosome 2: 5047995-5046796)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AK111037                         5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of AK111037

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakAclone-5047098-103

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG613GTGGGGGC      PPDB Motif  PLACE Motif 
 OsREG433GCCCAATT               PPDB MotifGCCCA  PLACE Motif 
 OsREG493     ATTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG625      TTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG563       TTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542        TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538         GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614          GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616           GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544            CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446             CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504              GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
 OsREG592TTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543       CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489         GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431          GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610           GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+5047299J075001E02, J075001E02, J075117E23, J075117F23, J075144M12, J075145H10, J075186B15

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCTCTCCTTCCTCT+50473215047337J075001E02, J075117E23, J075117F23, J075144M12, J075145H10, J075186B15

REG information

TypeSequenceAnnotationGenome positionGene model
REGGTGGCCCACCC+50470115047021J075001E02, J075117E23, J075117F23, J075144M12, J075145H10, J075186B15
REGCGGATCGG+50470365047043J075001E02, J075117E23, J075117F23, J075144M12, J075145H10, J075186B15
REGTTTTGGGCCCAACC+50471285047141J075001E02, J075117E23, J075117F23, J075144M12, J075145H10, J075186B15
REGCTTGGGCCCCCAC+50471795047191J075001E02, J075117E23, J075117F23, J075144M12, J075145H10, J075186B15
 OsREG613     GCCCCCAC PPDB Motif  PLACE Motif 
REGCACGGCCCGGCCCAAATTGGGC+50472315047252J075001E02, J075117E23, J075117F23, J075144M12, J075145H10, J075186B15
 OsREG504CACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG              PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG             PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC            PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC           PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG563       CGGCCCAA        PPDB MotifGCCCA  PLACE Motif 
 OsREG625        GGCCCAAA       PPDB MotifGCCCA  PLACE Motif 
 OsREG493         GCCCAAAT      PPDB MotifGCCCA  PLACE Motif 
 OsREG433              AATTGGGC PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.