version
PlantPromoterDB promoter information of AK111041

Summary of Gene (AK111041)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0306100        NCBI 
Gene model AK111041  
Description Plant specific eukaryotic initiation factor 4B family protein.  
#
#

Overview

Focused view (chromosome 1: 11414291-11413092)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK111041                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK111041

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-11413300-9

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCGCGC-1141334611413353-55-62
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 
REGGACCGTTG-1141344011413447-149-156
 OsREG495GACCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGTTTCGGCCCAAT-1141355111413562-260-271
 OsREG634TTTCGGCC     PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCGAGA-1141356511413577-274-286
 OsREG605TTATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635     GGCCGAGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.