version
PlantPromoterDB promoter information of AK111056

Summary of Gene (AK111056)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0636600        NCBI 
Gene model AK111056  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 12: 27522067-27520868)

Genome position     
from initiation codon
AK071648            
J023106H02          
J033101J20          
J065083H14          
J065174L14          
J075001E12          
J075020F15          
J075031K18          
J075041I23          
J075074L05          
J075101N08          
J075140I08          
J075168C03          
J090029O13          
J090060I24          
TSS from cDNA
TSS information
AK111056                         5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK111056

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-27521097-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCT-2752110427521112-37-45
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG-2752120727521214-140-147
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGGGCCCGTT-2752122427521231-157-164
 OsREG424GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAATTGGGCCGTT-2752127327521284-206-217
 OsREG433AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423    GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
REGGGATGGGCTGA-2752130127521311-234-244
 OsREG608GGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.