version
PlantPromoterDB promoter information of AK111294

Summary of Gene (AK111294)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0686700        NCBI 
Gene model AK111294  
Description Protein of unknown function DUF581 family protein.  
#
#

Overview

Focused view (chromosome 2: 29021244-29020045)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK111294                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK111294

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-29020498-254

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCACTATATAA-2902052429020534-280-290
Y PatchCCCCTCCC-2902053329020540-289-296
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTCCCAC-2902055829020565-314-321
 OsREG650GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGAGCCCACAGACAGGTGGGACCCG-2902058129020603-337-359
 OsREG461AGCCCACA                PPDB MotifGCCCA  PLACE Motif 
 OsREG501        GACAGGTG        PPDB Motif  PLACE Motif 
 OsREG436         ACAGGTGG       PPDB Motif  PLACE Motif 
 OsREG514          CAGGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG651            GGTGGGAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG650             GTGGGACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648              TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG569               GGGACCCG PPDB MotifGGGACCC  PLACE Motif 
REGCGTGGGGCCCACCT-2902065229020665-408-421
 OsREG572CGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGCGGGTCG-2902067129020678-427-434
 OsREG552GCGGGTCG PPDB Motif  PLACE Motif 
REGAGGGCCCACTCC-2902072029020731-476-487
 OsREG475AGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG532    CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGCCACCAAC-2902073729020744-493-500
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCCACTGAC-2902075429020761-510-517
 OsREG522CCACTGAC PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.