version
PlantPromoterDB promoter information of AK111308

Summary of Gene (AK111308)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0785600        NCBI 
Gene model AK111308  
Description Methyltransferase type 11 domain containing protein.  
#
#

Overview

Focused view (chromosome 1: 35074730-35073531)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK111308                         5'->3' (-)
Promoter sequence









 
AK100774            
AK102081            
AY129829            
J023120B17          
J033082K10          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK111308

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-35073758-28

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAGCCCAATA-3507381035073825-80-95
 OsREG660TTGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511      CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460       AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596        GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGGGGCTTGG-3507401435074021-284-291
 OsREG519GGGCTTGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+35073903AK102081, AK102081, J033082K10, AK100774, J023120B17, AY129829

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCCCTC+3507387735073888AK100774, AK102081, AY129829, J023120B17, J033082K10
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCCGTTGGGCCTG+3507376635073779AK100774, AK102081, AY129829, J023120B17, J033082K10
 OsREG469AGCCGTTG       PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG      PPDB MotifCCAACGG  PLACE Motif 
 OsREG626    GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG471     TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513      TGGGCCTG PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCTGGGCCAA+3507381035073825AK100774, AK102081, AY129829, J023120B17, J033082K10
 OsREG596TATTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG620      GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578       CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660        TGGGCCAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.