version
PlantPromoterDB promoter information of AK111366

Summary of Gene (AK111366)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0544700        NCBI 
Gene model AK111366  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 8: 27386000-27384801)

Genome position     
from initiation codon
009-168-G01         
011-046-D09         
012-003-C08         
012-042-B06         
013-035-H12         
013-072-A10         
014-010-B11         
014-097-E06         
015-003-E12         
015-040-B04         
AK060536            
AK102666            
AK119660            
D87261              
J090049N23          
J090084G06          
TSS from cDNA
TSS information
AK111366                         5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK111366

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-27384211-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACAC-2738448227384489-332-339
 OsREG535CCCCACAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-27385839AK119660, AK119660, J090049N23, J090084G06, 013-072-A10, 011-046-D09, 009-168-G01, 012-003-C08, AK102666, 014-097-E06, 014-010-B11, D87261, 015-003-E12, 015-040-B04, AK060536, 013-035-H12, 012-042-B06

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCCCC-2738580427385812009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCGGGCC-2738592027385927009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG539CCCGGGCC PPDB Motif  PLACE Motif 
REGCGGGTCCCCACCAC-2738594827385961009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG569CGGGTCCC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG527      CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCGGT-2738597327385982009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG567GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG543 GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG441  GGCCCGGT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.