version
PlantPromoterDB promoter information of AK111366

Summary of Gene (AK111366)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0544700        NCBI 
Gene model AK111366  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 8: 27387000-27385801)

Genome position     
from initiation codon
009-168-G01         
011-046-D09         
012-042-B06         
013-035-H12         
014-010-B11         
014-097-E06         
015-003-E12         
015-040-B04         
AK060536            
AK102666            
AK119660            
J090049N23          
J090084G06          
TSS from cDNA
TSS information
AK111366                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK111366

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-27384211-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACAC-2738448227384489-332-339
 OsREG535CCCCACAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-27385839AK119660, AK119660, J090049N23, J090084G06, 013-072-A10, 011-046-D09, 009-168-G01, 012-003-C08, AK102666, 014-097-E06, 014-010-B11, D87261, 015-003-E12, 015-040-B04, AK060536, 013-035-H12, 012-042-B06

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCCCC-2738580427385812009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCGGGCC-2738592027385927009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG539CCCGGGCC PPDB Motif  PLACE Motif 
REGCGGGTCCCCACCAC-2738594827385961009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG569CGGGTCCC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG527      CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCGGT-2738597327385982009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG567GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG543 GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG441  GGCCCGGT PPDB Motif  PLACE Motif 
REGACGCGTCCTGGGCCGTCGGATC-2738600927386030009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG442ACGCGTCC               PPDB Motif  PLACE Motif 
 OsREG550      CCTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG565       CTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG445        TGGGCCGT       PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584         GGGCCGTC      PPDB MotifGCCCA  PLACE Motif 
 OsREG546            CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483             CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588              GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGCGGGTCCC-2738605927386066009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG569CGGGTCCC PPDB MotifGGGACCC  PLACE Motif 
REGGTGTGGGGCCCACGCG-2738607427386089009-168-G01, 011-046-D09, 012-003-C08, 012-042-B06, 013-035-H12, 013-072-A10, 014-010-B11, 014-097-E06, 015-003-E12, 015-040-B04, AK060536, AK102666, AK119660, D87261, J090049N23, J090084G06
 OsREG535GTGTGGGG         PPDB Motif  PLACE Motif 
 OsREG611 TGTGGGGC        PPDB Motif  PLACE Motif 
 OsREG631  GTGGGGCC       PPDB Motif  PLACE Motif 
 OsREG641   TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647    GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571      GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG602       GCCCACGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG530        CCCACGCG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.