version
PlantPromoterDB promoter information of AK111396

Summary of Gene (AK111396)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0149400        NCBI 
Gene model AK111396  
Description Protein prenyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 3: 2735072-2736271)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK111396                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK111396

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2735953-119

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTC+27357632735770-309-302
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCGGTGCGGTGCG+27357752735787-297-285
 OsREG554GCGGTGCGGTGCG PPDB Motif  PLACE Motif 
 OsREG500   GTGCGGTG   PPDB Motif  PLACE Motif 
REGAGCCCATT+27358262735833-246-239
 OsREG432AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCTTTCAAGGCCCAACC+27358402735861-232-211
 OsREG459CTTGGGCT               PPDB MotifGCCCA  PLACE Motif 
 OsREG426 TTGGGCTT              PPDB MotifGCCCA  PLACE Motif 
 OsREG421  TGGGCTTT             PPDB MotifGCCCA  PLACE Motif 
 OsREG497          CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430           AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471            AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626             GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595              GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCCCACA+27358642735875-208-197
 OsREG521CCACGGCC     PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCAACCAGCCCAAG+27358912735909-181-163
 OsREG430AAGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC          PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595   GCCCAACC         PPDB MotifGCCCA  PLACE Motif 
 OsREG523         CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511          CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459           AGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.