version
PlantPromoterDB promoter information of AK112068

Summary of Gene (AK112068)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0567300        NCBI 
Gene model AK112068  
Description GTP-binding protein, HSR1-related domain containing protein.  
#
#

Overview

Focused view (chromosome 5: 28327292-28326093)

Genome position     
from initiation codon
013-039-F11         
TSS from cDNA
TSS information
AK112068                         5'->3' (-)
Promoter sequence









 
011-098-G02         
AK101119            
J033025I04          
J043024F24          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK112068

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28326352-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATTGGGCCGGCCCAAG-2832646028326476-168-184
 OsREG596TATTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581         GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCAGCCCAAG-2832649928326515-207-223
 OsREG592TTTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG       PPDB MotifGCCCA  PLACE Motif 
 OsREG523       CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511        CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459         AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCTTTGTTGGGCCGGT-2832652528326546-233-254
 OsREG525CCATGGGC               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467 CATGGGCT              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT             PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG594          TGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626           GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563            TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542             TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440              GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.