version
PlantPromoterDB promoter information of AK119239

Summary of Gene (AK119239)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0266300        NCBI 
Gene model AK119239  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 8855447-8856646)

Genome position     
from initiation codon
006-027-H06         
013-051-G08         
014-002-C05         
014-002-H02         
014-005-A09         
014-008-D02         
014-008-G06         
014-009-C12         
014-010-A07         
014-012-H03         
014-013-E03         
014-014-D03         
014-028-C09         
014-037-G05         
014-038-E04         
014-041-F08         
014-049-E11         
014-050-A05         
014-053-F10         
014-054-C04         
014-056-A01         
014-060-A08         
014-072-C09         
014-072-D02         
014-077-G08         
014-080-C10         
014-098-E01         
014-100-C02         
014-100-E03         
014-100-E10         
015-061-D06         
016-033-H10         
AB110191            
AK073671            
AK104129            
AK119616            
AK119664            
AK119675            
D21285              
J033051H23          
J065036L24          
J065045J20          
J065104C03          
J065109J20          
J065116F24          
J065146F06          
J065146P18          
J065167A09          
J065183K12          
J075019J15          
J075112F10          
J075150H04          
J075159N20          
J075164P19          
J075185O05          
J100030A19          
J100044E07          
TSS from cDNA
TSS information
AK119239                         5'->3' (+)
Promoter sequence





 
J075087I01          
J090027J05          
J090056C16          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK119239

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+8856230-217
TSS clone peakAclone+8856343-104

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCT+88563238856330-124-117
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAGCCC+88559318855939-516-508
 OsREG603GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533 CCCAGCCC PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCCA+88560708856080-377-367
 OsREG627TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCACA+88560888856097-359-350
 OsREG487ATGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.