version
PlantPromoterDB promoter information of AK119253

Summary of Gene (AK119253)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0658600        NCBI 
Gene model AK119253  
Description Nucleolar, Nop52 family protein.  
#
#

Overview

Focused view (chromosome 4: 33991282-33990083)

Genome position     
from initiation codon
AK064729            
TSS from cDNA
TSS information
AK119253                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK119253

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33990371-89
TSS clone peakAclone-33990284-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAAA-3399039533990402-113-120
Y PatchCCCTCCCCC-3399031833990326-36-44
Y PatchCCCCTTCC-3399035733990364-75-82
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGACGCG-3399041433990422-132-140
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGGCCCCCAC-3399042633990433-144-151
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGCGTTGGAT-3399046433990471-182-189
 OsREG481CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGTACGGCCCATCA-3399055833990569-276-287
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCCCACGG-3399059233990604-310-322
 OsREG521CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG547     GCCCACGG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCGGC-3399062533990635-343-353
 OsREG627TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.