version
PlantPromoterDB promoter information of AK119421

Summary of Gene (AK119421)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0580000        NCBI 
Gene model AK119421  
Description Armadillo-like helical domain containing protein.  
#
#

Overview

Focused view (chromosome 11: 23748505-23749704)

Genome position     
from initiation codon
AK121905            
J033105I06          
J090022C10          
J090024J23          
J090044F24          
TSS from cDNA
TSS information
AK119421                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK119421

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+23748883-622

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGCCCAACT+2374858423748593-921-912
 OsREG426AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458 AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479  GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGAGACGCG+2374866423748671-841-834
 OsREG560GAGACGCG PPDB Motif  PLACE Motif 
REGCACACACC+2374870023748707-805-798
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGCTGACAGGTGGGCCCCAG+2374871823748735-787-770
 OsREG551CTGACAGG           PPDB Motif  PLACE MotifTGAC 
 OsREG501  GACAGGTG         PPDB Motif  PLACE Motif 
 OsREG436   ACAGGTGG        PPDB Motif  PLACE Motif 
 OsREG514    CAGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG476     AGGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647        TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641         GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG580          GGCCCCAG PPDB Motif  PLACE Motif 
REGCGCGTCTC+2374874023748747-765-758
 OsREG560CGCGTCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.