version
PlantPromoterDB promoter information of AK119553

Summary of Gene (AK119553)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0183300        NCBI 
Gene model AK119553  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 4347683-4346484)

Genome position     
from initiation codon
AK106987            
J065001J11          
J065013J06          
J065025E10          
J065039L04          
J065041H08          
J065046C23          
J065049D09          
J065057M12          
J065083P08          
J065096G10          
J065132D06          
J065139F18          
J065159E02          
J075161E24          
J075182J22          
J100053C12          
J100085D04          
TSS from cDNA
TSS information
AK119553                         5'->3' (-)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK119553

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4351794-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCCTTCCTC-43517954351808-62-75
Y PatchCCCCCCTCCCCC-43518304351841-97-108
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCGTGGGCCCCACCCACCTG-43519334351957-200-224
 OsREG537CCCCCGCG                  PPDB Motif  PLACE Motif 
 OsREG530    CGCGTGGG              PPDB MotifGCCCA  PLACE Motif 
 OsREG602     GCGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG571      CGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647        TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641         GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631          GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612           GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG514                 CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCAAGTGGG-43520004352007-267-274
 OsREG498CAAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCG-43520284352036-295-303
 OsREG504CACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-4346789AK106987, J065001J11, J065096G10, J065139F18, J065039L04, J065046C23, J065057M12, J065083P08, J065159E02, J065132D06, J100053C12, J100085D04, J065041H08, AK106987, J065013J06, J065025E10, J075161E24, J075182J22, J065049D09

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCCTC-43467874346794AK106987, J065001J11, J065013J06, J065025E10, J065039L04, J065041H08, J065046C23, J065049D09, J065057M12, J065083P08, J065096G10, J065132D06, J065139F18, J065159E02, J075161E24, J075182J22, J100053C12, J100085D04
Y PatchTCTCCCCC-43468134346820AK106987, J065001J11, J065013J06, J065025E10, J065039L04, J065041H08, J065046C23, J065049D09, J065057M12, J065083P08, J065096G10, J065132D06, J065139F18, J065159E02, J075161E24, J075182J22, J100053C12, J100085D04
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCCACGAA-43468744346882AK106987, J065001J11, J065013J06, J065025E10, J065039L04, J065041H08, J065046C23, J065049D09, J065057M12, J065083P08, J065096G10, J065132D06, J065139F18, J065159E02, J075161E24, J075182J22, J100053C12, J100085D04
 OsREG601GCCCACGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG529 CCCACGAA PPDB MotifGCCCA  PLACE Motif 
REGCGGCTCGG-43468994346906AK106987, J065001J11, J065013J06, J065025E10, J065039L04, J065041H08, J065046C23, J065049D09, J065057M12, J065083P08, J065096G10, J065132D06, J065139F18, J065159E02, J075161E24, J075182J22, J100053C12, J100085D04
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.