version
PlantPromoterDB promoter information of AK119703

Summary of Gene (AK119703)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0482200        NCBI 
Gene model AK119703  
Description Thioredoxin fold domain containing protein.  
#
#

Overview

Focused view (chromosome 6: 17244437-17243238)

Genome position     
from initiation codon
J065014B11          
J065055E22          
J065092L13          
J065113E21          
J065191D11          
J065214F18          
J075104E18          
J075149O19          
J075170I11          
TSS from cDNA
TSS information
AK119703                         5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK119703

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-17243456-469

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCTTTC-1724345617243467-469-480
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTTGGGCCGCA-1724351117243522-524-535
 OsREG594TGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643    GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCAATA-1724358617243596-599-609
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGGGGCCAGA-1724362817243635-641-648
 OsREG638GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-1724366917243676-682-689
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.